Pre Draft Discussion

[Jwetz83]

Take Doncic 1 and then trade for pick 4.

One of the bigs will fall in the suns lap.

[bwoolf2]

Memphis: Warren, Bender or Chriss #16, bucks pick, and next years 1st un protected future 1st

Suns: #3 Parson, Bazemore

Atlanta: Filler #4 Miami Pick, 31, and some additional 2nd rounders...

Highly unlikely but thats about the only way to get it done, Warren, one of Chriss or Bender, take back some crappy contracts and 5 1st round picks...

[Saberestar]

Read on Twitter

[BobbieL]

Read on Twitter

Mavs have enough cap to take on Bazemore outright.

Suns might have needed to move Williams, Ulis and House and that probably would have done it but the Hawks want Trae Young

Dammit - Mavs getting Doncic - good fit for Carlisle

[oddity]

Oh my.....Luka backers....WE BACK

Read on Twitter

Currently pulling out my hair in anticipation.

[JMac1]

Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.

[BobbieL]

Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.

I like Okobo or Huerter - would like the high upside PG prospect or the shooter

[WeekapaugGroove]

Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.

I'd love it but also don't buy it. Now if Porter slides to 10+ I could see Phoenix pounce. He scares the hell out of me but his potential fit at the 4 is undeniable.

Sent from my Pixel 2 XL using RealGM mobile app

[BobbieL]

Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.

I'd love it but also don't buy it. Now if Porter slides to 10+ I could see Phoenix pounce. He scares the hell out of me but his potential fit at the 4 is undeniable.

Sent from my Pixel 2 XL using RealGM mobile app

actually maybe 16 and Bucks pick is worth to me - to take a flier on the guy

his upside potential would be great next to Ayton and Jackson

[sunskerr]

Getting Doncic too seems like a pipe dream at this point. Only way it can happen is that Atlanta takes Trae @ 3, imo. But they'd be crazy to pass on Doncic when they can trade him to whomever drafted Trae...

Wait a minute. They can take Doncic and we can draft Trae @ 4, provided we have Memphis' pick, leapfrogging the Mavericks. Then we just hold Trae hostage + whatever for Doncic. This is fair enough, right?

[timetoshinebaby]

Or the team picking at 4 takes who Atlanta wants at 5. Assuming we really know who Atlanta wants at 5 and Young isn't a smokescreen.

[Kerrsed]

Read on Twitter

[sunskerr]

Read on Twitter

Barkley is a covert Suns fan

[Saberestar]

Read on Twitter

[BobbieL]

Read on Twitter

funny - sounds like the Chuckster


need to find a point guard who knows how to throw a lob as between Ayton and Chriss - they should be able to catch and throw down lobs!

now that its happening - i am good with Ayton. Like I said, he likes KG - so I hope he plays defense and rebound with passion on that end. I am not concerned about the offense. Just bring the passion on defense and rebounding!

[BobbieL]

Read on Twitter

I will say this - Casey Jacobson was on 910 and he thinks the pick at 16 - unless the player drops like Porter or somebody with such high upside - the player to take is a guy that can help. Ayton is the high upside pick already - I agree, maybe go for the player that has a skill set that will help this year. Even without the higher upside potential - So if its Huerter, Divi or Brunson, I get it

[sunskerr]

Read on Twitter

His DNA?

AACGTTTGATGCTCCAGTCCAGCTAAGCCACCAGCTAAGGGAAGCTAAGGGGTTGATGCGCTGATGCTCCAGTGATGCGCTGATGCTCCAGTGGAACGT

So much potential. Wow.

[bigfoot]

I would be happy with Doncic #1 and trading up for any of the bigs available (Bamba, Carter, Jackson Jr, Bagley)

[Kerrsed]

Read on Twitter

[Saberestar]

Read on Twitter