Pre Draft Discussion
Moderators: bwgood77, lilfishi22, Qwigglez
Re: Pre Draft Discussion
-
Jwetz83
- Freshman
- Posts: 84
- And1: 71
- Joined: Mar 01, 2018
Re: Pre Draft Discussion
Take Doncic 1 and then trade for pick 4.
One of the bigs will fall in the suns lap.
One of the bigs will fall in the suns lap.
Re: Pre Draft Discussion
-
bwoolf2
- Lead Assistant
- Posts: 4,849
- And1: 4,306
- Joined: Jun 26, 2014
Re: Pre Draft Discussion
Memphis: Warren, Bender or Chriss #16, bucks pick, and next years 1st un protected future 1st
Suns: #3 Parson, Bazemore
Atlanta: Filler #4 Miami Pick, 31, and some additional 2nd rounders...
Highly unlikely but thats about the only way to get it done, Warren, one of Chriss or Bender, take back some crappy contracts and 5 1st round picks...
Suns: #3 Parson, Bazemore
Atlanta: Filler #4 Miami Pick, 31, and some additional 2nd rounders...
Highly unlikely but thats about the only way to get it done, Warren, one of Chriss or Bender, take back some crappy contracts and 5 1st round picks...
Re: Pre Draft Discussion
-
Saberestar
- RealGM
- Posts: 22,565
- And1: 17,181
- Joined: May 21, 2010
Re: Pre Draft Discussion
-
BobbieL
- RealGM
- Posts: 15,353
- And1: 8,997
- Joined: Jun 24, 2009
Re: Pre Draft Discussion
Saberestar wrote:
Mavs have enough cap to take on Bazemore outright.
Suns might have needed to move Williams, Ulis and House and that probably would have done it but the Hawks want Trae Young
Dammit - Mavs getting Doncic - good fit for Carlisle
Re: Pre Draft Discussion
- oddity
- Pro Prospect
- Posts: 941
- And1: 1,088
- Joined: Jul 03, 2015
-
Re: Pre Draft Discussion
Currently pulling out my hair in anticipation.
Living off borrowed time the clock ticks faster...
Re: Pre Draft Discussion
-
JMac1
- Suns Forum Training Specialist
- Posts: 10,032
- And1: 4,004
- Joined: May 23, 2009
Re: Pre Draft Discussion
Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
Re: Pre Draft Discussion
-
BobbieL
- RealGM
- Posts: 15,353
- And1: 8,997
- Joined: Jun 24, 2009
Re: Pre Draft Discussion
JMac1 wrote:Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
I like Okobo or Huerter - would like the high upside PG prospect or the shooter
Re: RE: Re: Pre Draft Discussion
-
WeekapaugGroove
- RealGM
- Posts: 24,538
- And1: 20,241
- Joined: Feb 07, 2010
Re: RE: Re: Pre Draft Discussion
I'd love it but also don't buy it. Now if Porter slides to 10+ I could see Phoenix pounce. He scares the hell out of me but his potential fit at the 4 is undeniable.JMac1 wrote:Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
Sent from my Pixel 2 XL using RealGM mobile app
Life should not be a journey to the grave with the intention of arriving safely in a pretty and well preserved body, but rather to skid in broadside in a cloud of smoke, thoroughly used up, totally worn out, and loudly proclaiming Wow! What a Ride!-H.S.T.
Re: RE: Re: Pre Draft Discussion
-
BobbieL
- RealGM
- Posts: 15,353
- And1: 8,997
- Joined: Jun 24, 2009
Re: RE: Re: Pre Draft Discussion
WeekapaugGroove wrote:I'd love it but also don't buy it. Now if Porter slides to 10+ I could see Phoenix pounce. He scares the hell out of me but his potential fit at the 4 is undeniable.JMac1 wrote:Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
Sent from my Pixel 2 XL using RealGM mobile app
actually maybe 16 and Bucks pick is worth to me - to take a flier on the guy
his upside potential would be great next to Ayton and Jackson
Re: Pre Draft Discussion
- sunskerr
- General Manager
- Posts: 9,878
- And1: 6,022
- Joined: Feb 20, 2010
-
Re: Pre Draft Discussion
Getting Doncic too seems like a pipe dream at this point. Only way it can happen is that Atlanta takes Trae @ 3, imo. But they'd be crazy to pass on Doncic when they can trade him to whomever drafted Trae...
Wait a minute. They can take Doncic and we can draft Trae @ 4, provided we have Memphis' pick, leapfrogging the Mavericks. Then we just hold Trae hostage + whatever for Doncic. This is fair enough, right?
Wait a minute. They can take Doncic and we can draft Trae @ 4, provided we have Memphis' pick, leapfrogging the Mavericks. Then we just hold Trae hostage + whatever for Doncic. This is fair enough, right?
Re: Pre Draft Discussion
-
timetoshinebaby
- Junior
- Posts: 363
- And1: 309
- Joined: Jan 30, 2018
-
Re: Pre Draft Discussion
Or the team picking at 4 takes who Atlanta wants at 5. Assuming we really know who Atlanta wants at 5 and Young isn't a smokescreen.
Re: Pre Draft Discussion
- Kerrsed
- Retired Mod

- Posts: 29,876
- And1: 16,578
- Joined: Mar 31, 2009
- Location: Land of the Internet Memes
- Contact:
-
Re: Pre Draft Discussion
Its #DUMPSTERFIRE SEASON! #TeamTRAINWRECK -KERRSED- The Mod, The Myth, The Legend


Re: Pre Draft Discussion
- sunskerr
- General Manager
- Posts: 9,878
- And1: 6,022
- Joined: Feb 20, 2010
-
Re: Pre Draft Discussion
-
Saberestar
- RealGM
- Posts: 22,565
- And1: 17,181
- Joined: May 21, 2010
Re: Pre Draft Discussion
-
BobbieL
- RealGM
- Posts: 15,353
- And1: 8,997
- Joined: Jun 24, 2009
Re: Pre Draft Discussion
Kerrsed wrote:
funny - sounds like the Chuckster
need to find a point guard who knows how to throw a lob as between Ayton and Chriss - they should be able to catch and throw down lobs!
now that its happening - i am good with Ayton. Like I said, he likes KG - so I hope he plays defense and rebound with passion on that end. I am not concerned about the offense. Just bring the passion on defense and rebounding!
Re: Pre Draft Discussion
-
BobbieL
- RealGM
- Posts: 15,353
- And1: 8,997
- Joined: Jun 24, 2009
Re: Pre Draft Discussion
Saberestar wrote:
I will say this - Casey Jacobson was on 910 and he thinks the pick at 16 - unless the player drops like Porter or somebody with such high upside - the player to take is a guy that can help. Ayton is the high upside pick already - I agree, maybe go for the player that has a skill set that will help this year. Even without the higher upside potential - So if its Huerter, Divi or Brunson, I get it
Re: Pre Draft Discussion
- sunskerr
- General Manager
- Posts: 9,878
- And1: 6,022
- Joined: Feb 20, 2010
-
Re: Pre Draft Discussion
Saberestar wrote:
His DNA?
AACGTTTGATGCTCCAGTCCAGCTAAGCCACCAGCTAAGGGAAGCTAAGGGGTTGATGCGCTGATGCTCCAGTGATGCGCTGATGCTCCAGTGGAACGT
So much potential. Wow.
Re: Pre Draft Discussion
- bigfoot
- Suns Forum Anti-Tank Commander
- Posts: 10,070
- And1: 6,665
- Joined: Sep 16, 2010
-
Re: Pre Draft Discussion
I would be happy with Doncic #1 and trading up for any of the bigs available (Bamba, Carter, Jackson Jr, Bagley)
Re: Pre Draft Discussion
- Kerrsed
- Retired Mod

- Posts: 29,876
- And1: 16,578
- Joined: Mar 31, 2009
- Location: Land of the Internet Memes
- Contact:
-
Re: Pre Draft Discussion
Its #DUMPSTERFIRE SEASON! #TeamTRAINWRECK -KERRSED- The Mod, The Myth, The Legend


Re: Pre Draft Discussion
-
Saberestar
- RealGM
- Posts: 22,565
- And1: 17,181
- Joined: May 21, 2010






