ImageImageImage

Pre Draft Discussion

Moderators: bwgood77, lilfishi22, Qwigglez

Who would you rather take at 16 if one of these guys slipped?

Collin Sexton
22
45%
Miles Bridges
27
55%
 
Total votes: 49

Jwetz83
Freshman
Posts: 84
And1: 71
Joined: Mar 01, 2018

Re: Pre Draft Discussion 

Post#2001 » by Jwetz83 » Thu Jun 21, 2018 10:06 pm

Take Doncic 1 and then trade for pick 4.

One of the bigs will fall in the suns lap.
bwoolf2
Lead Assistant
Posts: 4,849
And1: 4,306
Joined: Jun 26, 2014

Re: Pre Draft Discussion 

Post#2002 » by bwoolf2 » Thu Jun 21, 2018 10:06 pm

Memphis: Warren, Bender or Chriss #16, bucks pick, and next years 1st un protected future 1st

Suns: #3 Parson, Bazemore

Atlanta: Filler #4 Miami Pick, 31, and some additional 2nd rounders...

Highly unlikely but thats about the only way to get it done, Warren, one of Chriss or Bender, take back some crappy contracts and 5 1st round picks...
Saberestar
RealGM
Posts: 22,608
And1: 17,216
Joined: May 21, 2010

Re: Pre Draft Discussion 

Post#2003 » by Saberestar » Thu Jun 21, 2018 10:07 pm

Read on Twitter
BobbieL
RealGM
Posts: 15,353
And1: 8,997
Joined: Jun 24, 2009

Re: Pre Draft Discussion 

Post#2004 » by BobbieL » Thu Jun 21, 2018 10:12 pm

Saberestar wrote:
Read on Twitter


Mavs have enough cap to take on Bazemore outright.

Suns might have needed to move Williams, Ulis and House and that probably would have done it but the Hawks want Trae Young

Dammit - Mavs getting Doncic - good fit for Carlisle
User avatar
oddity
Pro Prospect
Posts: 941
And1: 1,088
Joined: Jul 03, 2015
 

Re: Pre Draft Discussion 

Post#2005 » by oddity » Thu Jun 21, 2018 10:12 pm

GeraldsGreenery wrote:Oh my.....Luka backers....WE BACK

Read on Twitter

Currently pulling out my hair in anticipation.
Living off borrowed time the clock ticks faster...
JMac1
Suns Forum Training Specialist
Posts: 10,032
And1: 4,004
Joined: May 23, 2009

Re: Pre Draft Discussion 

Post#2006 » by JMac1 » Thu Jun 21, 2018 10:15 pm

Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
BobbieL
RealGM
Posts: 15,353
And1: 8,997
Joined: Jun 24, 2009

Re: Pre Draft Discussion 

Post#2007 » by BobbieL » Thu Jun 21, 2018 10:17 pm

JMac1 wrote:Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.


I like Okobo or Huerter - would like the high upside PG prospect or the shooter
WeekapaugGroove
RealGM
Posts: 24,538
And1: 20,241
Joined: Feb 07, 2010

Re: RE: Re: Pre Draft Discussion 

Post#2008 » by WeekapaugGroove » Thu Jun 21, 2018 10:18 pm

JMac1 wrote:Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
I'd love it but also don't buy it. Now if Porter slides to 10+ I could see Phoenix pounce. He scares the hell out of me but his potential fit at the 4 is undeniable.

Sent from my Pixel 2 XL using RealGM mobile app
Life should not be a journey to the grave with the intention of arriving safely in a pretty and well preserved body, but rather to skid in broadside in a cloud of smoke, thoroughly used up, totally worn out, and loudly proclaiming Wow! What a Ride!-H.S.T.
BobbieL
RealGM
Posts: 15,353
And1: 8,997
Joined: Jun 24, 2009

Re: RE: Re: Pre Draft Discussion 

Post#2009 » by BobbieL » Thu Jun 21, 2018 10:25 pm

WeekapaugGroove wrote:
JMac1 wrote:Okobo, Holiday or Donte at 16 for me. Not buying into the Doncic and Ayton story.
I'd love it but also don't buy it. Now if Porter slides to 10+ I could see Phoenix pounce. He scares the hell out of me but his potential fit at the 4 is undeniable.

Sent from my Pixel 2 XL using RealGM mobile app


actually maybe 16 and Bucks pick is worth to me - to take a flier on the guy

his upside potential would be great next to Ayton and Jackson
User avatar
sunskerr
General Manager
Posts: 9,892
And1: 6,032
Joined: Feb 20, 2010
 

Re: Pre Draft Discussion 

Post#2010 » by sunskerr » Thu Jun 21, 2018 10:27 pm

Getting Doncic too seems like a pipe dream at this point. Only way it can happen is that Atlanta takes Trae @ 3, imo. But they'd be crazy to pass on Doncic when they can trade him to whomever drafted Trae...

Wait a minute. They can take Doncic and we can draft Trae @ 4, provided we have Memphis' pick, leapfrogging the Mavericks. Then we just hold Trae hostage + whatever for Doncic. This is fair enough, right?
timetoshinebaby
Junior
Posts: 363
And1: 309
Joined: Jan 30, 2018
       

Re: Pre Draft Discussion 

Post#2011 » by timetoshinebaby » Thu Jun 21, 2018 10:30 pm

Or the team picking at 4 takes who Atlanta wants at 5. Assuming we really know who Atlanta wants at 5 and Young isn't a smokescreen.
User avatar
Kerrsed
Retired Mod
Retired Mod
Posts: 29,876
And1: 16,578
Joined: Mar 31, 2009
Location: Land of the Internet Memes
Contact:
     

Re: Pre Draft Discussion 

Post#2012 » by Kerrsed » Thu Jun 21, 2018 10:32 pm

Read on Twitter
Its #DUMPSTERFIRE SEASON! #TeamTRAINWRECK -KERRSED- The Mod, The Myth, The Legend
Image
User avatar
sunskerr
General Manager
Posts: 9,892
And1: 6,032
Joined: Feb 20, 2010
 

Re: Pre Draft Discussion 

Post#2013 » by sunskerr » Thu Jun 21, 2018 10:34 pm

Kerrsed wrote:
Read on Twitter


:lol: :lol: :lol:

Barkley is a covert Suns fan
Saberestar
RealGM
Posts: 22,608
And1: 17,216
Joined: May 21, 2010

Re: Pre Draft Discussion 

Post#2014 » by Saberestar » Thu Jun 21, 2018 10:35 pm

Read on Twitter
BobbieL
RealGM
Posts: 15,353
And1: 8,997
Joined: Jun 24, 2009

Re: Pre Draft Discussion 

Post#2015 » by BobbieL » Thu Jun 21, 2018 10:35 pm

Kerrsed wrote:
Read on Twitter


funny - sounds like the Chuckster


need to find a point guard who knows how to throw a lob as between Ayton and Chriss - they should be able to catch and throw down lobs!

now that its happening - i am good with Ayton. Like I said, he likes KG - so I hope he plays defense and rebound with passion on that end. I am not concerned about the offense. Just bring the passion on defense and rebounding!
BobbieL
RealGM
Posts: 15,353
And1: 8,997
Joined: Jun 24, 2009

Re: Pre Draft Discussion 

Post#2016 » by BobbieL » Thu Jun 21, 2018 10:37 pm

Saberestar wrote:
Read on Twitter


I will say this - Casey Jacobson was on 910 and he thinks the pick at 16 - unless the player drops like Porter or somebody with such high upside - the player to take is a guy that can help. Ayton is the high upside pick already - I agree, maybe go for the player that has a skill set that will help this year. Even without the higher upside potential - So if its Huerter, Divi or Brunson, I get it
User avatar
sunskerr
General Manager
Posts: 9,892
And1: 6,032
Joined: Feb 20, 2010
 

Re: Pre Draft Discussion 

Post#2017 » by sunskerr » Thu Jun 21, 2018 10:38 pm

Saberestar wrote:
Read on Twitter


His DNA?

AACGTTTGATGCTCCAGTCCAGCTAAGCCACCAGCTAAGGGAAGCTAAGGGGTTGATGCGCTGATGCTCCAGTGATGCGCTGATGCTCCAGTGGAACGT

So much potential. Wow.
User avatar
bigfoot
Suns Forum Anti-Tank Commander
Posts: 10,082
And1: 6,683
Joined: Sep 16, 2010
 

Re: Pre Draft Discussion 

Post#2018 » by bigfoot » Thu Jun 21, 2018 10:39 pm

I would be happy with Doncic #1 and trading up for any of the bigs available (Bamba, Carter, Jackson Jr, Bagley)
User avatar
Kerrsed
Retired Mod
Retired Mod
Posts: 29,876
And1: 16,578
Joined: Mar 31, 2009
Location: Land of the Internet Memes
Contact:
     

Re: Pre Draft Discussion 

Post#2019 » by Kerrsed » Thu Jun 21, 2018 10:43 pm

Read on Twitter
Its #DUMPSTERFIRE SEASON! #TeamTRAINWRECK -KERRSED- The Mod, The Myth, The Legend
Image
Saberestar
RealGM
Posts: 22,608
And1: 17,216
Joined: May 21, 2010

Re: Pre Draft Discussion 

Post#2020 » by Saberestar » Thu Jun 21, 2018 10:43 pm

Read on Twitter

Return to Phoenix Suns